Review




Structured Review

TeleChem International stealth smp3 microarray spotting pin
Genomic <t>microarray</t> analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).
Stealth Smp3 Microarray Spotting Pin, supplied by TeleChem International, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/smp3+stealth+microarray+pins/smp3+pins/pmc02323242-244-15-20
Average 90 stars, based on 1 article reviews
stealth smp3 microarray spotting pin - by Bioz Stars, 2026-09
90/100 stars

Images

1) Product Images from "Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres"

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

Journal: Genome Biology

doi: 10.1186/gb-2007-8-7-r148

Genomic microarray analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).
Figure Legend Snippet: Genomic microarray analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).

Techniques Used: Microarray, Binding Assay, Chromatin Immunoprecipitation, Standard Deviation

The BBB neocentromere contains a major and a minor centromere chromatin domain. DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-A, CENP-C, and CENP-H from cell line BBB was hybridized to a custom made microarray containing 257 unique polymerase chain reaction (PCR) fragments. Three independent biological replicates were performed for each antibody, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input), were plotted on the y-axis with the standard error (SE) for each PCR fragment. Intensity ratios at least three times the standard deviation (SD) from the background mean (dashed line) were considered positives (see Materials and methods). An alpha satellite containing plasmid was included as a positive control (far right). (a) Centromere protein (CENP)-A ChIP. The major CENP-A domain was about 80.3 kilobases (kb; shaded region), with positive intensity ratios 1.17 to 2.46. The minor domain was about 8.5 kb (shaded region) and was approximately 162 kb downstream from the major domain; intensity ratios were 1.14 to 1.33. Background experimental mean was -0.39 ± 0.47 SD, one-tailed distribution cut-off was ≤ 0.68, positive values were ≥ 1.02 (dashed line). Alpha satellite = 1.63 ± 0.18 SE. (b) CENP-C ChIP. Major CENP-C domain was 87.8 kb (shaded region). Intensity ratios were 0.67 to 3.41. Minor domain was 8.5 kb; intensity ratios were 0.65 to 1.07 (shaded region). Background experimental mean was -0.37 ± 0.34 SD, one-tailed distribution cut-off was ≤ 0.31, positive values were ≥ 0.65 (dashed line). Alpha satellite = 2.36 ± 0.70 SE. (c) CENP-H ChIP. Major CENP-H domain was about 86.3 kb (shaded region), and positive intensity ratios were 0.64 to 3.35. Minor domain was about 1.9 kb (shaded region), and intensity ratios were 0.82 and 1.14. Background experimental mean was -0.33 ± 0.32 SD, one-tailed distribution cutoff was ≤ 0.56, positive values were ≥ 0.63 (dashed lines). Alpha sat = 2.06 ± 0.59 SE. (d) The 2.3 megabase (Mb) region included in the PCR CHIP. The central 350 kb region, covered by PCR fragments at high density. The adjacent megabase on either side of the central region, shown at a 10 fold reduced scale, was covered by PCR fragments at decreasing density. PCR microarray fragments listed in Table 1, found at the edges of CENP-A, CENP-C and CENP-H domains, and the negative values within the first domain, are shown. The major and minor chromatin domains are shown by the rectangles. The tiling path of the unique sequenced regions of each bacterial artificial chromosome (BAC) and their overlaps are shown within the 350 kb region. The corresponding Repeat Masker data from the Human Genome Browser at UCSC and thegenes in the area are indicated [50].
Figure Legend Snippet: The BBB neocentromere contains a major and a minor centromere chromatin domain. DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-A, CENP-C, and CENP-H from cell line BBB was hybridized to a custom made microarray containing 257 unique polymerase chain reaction (PCR) fragments. Three independent biological replicates were performed for each antibody, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input), were plotted on the y-axis with the standard error (SE) for each PCR fragment. Intensity ratios at least three times the standard deviation (SD) from the background mean (dashed line) were considered positives (see Materials and methods). An alpha satellite containing plasmid was included as a positive control (far right). (a) Centromere protein (CENP)-A ChIP. The major CENP-A domain was about 80.3 kilobases (kb; shaded region), with positive intensity ratios 1.17 to 2.46. The minor domain was about 8.5 kb (shaded region) and was approximately 162 kb downstream from the major domain; intensity ratios were 1.14 to 1.33. Background experimental mean was -0.39 ± 0.47 SD, one-tailed distribution cut-off was ≤ 0.68, positive values were ≥ 1.02 (dashed line). Alpha satellite = 1.63 ± 0.18 SE. (b) CENP-C ChIP. Major CENP-C domain was 87.8 kb (shaded region). Intensity ratios were 0.67 to 3.41. Minor domain was 8.5 kb; intensity ratios were 0.65 to 1.07 (shaded region). Background experimental mean was -0.37 ± 0.34 SD, one-tailed distribution cut-off was ≤ 0.31, positive values were ≥ 0.65 (dashed line). Alpha satellite = 2.36 ± 0.70 SE. (c) CENP-H ChIP. Major CENP-H domain was about 86.3 kb (shaded region), and positive intensity ratios were 0.64 to 3.35. Minor domain was about 1.9 kb (shaded region), and intensity ratios were 0.82 and 1.14. Background experimental mean was -0.33 ± 0.32 SD, one-tailed distribution cutoff was ≤ 0.56, positive values were ≥ 0.63 (dashed lines). Alpha sat = 2.06 ± 0.59 SE. (d) The 2.3 megabase (Mb) region included in the PCR CHIP. The central 350 kb region, covered by PCR fragments at high density. The adjacent megabase on either side of the central region, shown at a 10 fold reduced scale, was covered by PCR fragments at decreasing density. PCR microarray fragments listed in Table 1, found at the edges of CENP-A, CENP-C and CENP-H domains, and the negative values within the first domain, are shown. The major and minor chromatin domains are shown by the rectangles. The tiling path of the unique sequenced regions of each bacterial artificial chromosome (BAC) and their overlaps are shown within the 350 kb region. The corresponding Repeat Masker data from the Human Genome Browser at UCSC and thegenes in the area are indicated [50].

Techniques Used: Chromatin Immunoprecipitation, Microarray, Polymerase Chain Reaction, Standard Deviation, Plasmid Preparation, Positive Control, One-tailed Test

PCR  microarray  and qRT-PCR values across the CENP-A major and minor domains
Figure Legend Snippet: PCR microarray and qRT-PCR values across the CENP-A major and minor domains

Techniques Used: Microarray

qRT-PCR confirms two separate CenpA domains in the neocentromeric cell line BBB. (a) Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on equal amounts of total DNA obtained from centromere protein (CENP)-A chromatin immunoprecipitation (ChIP) DNA and Input DNA from BBB cell line. The thirty-four PCR primer pairs used (shown as black lines in the x-axis) amplified fragments from 150 to 250 base pairs contained within the 350 kb neocentromere region (see Figure 2). Each primer pair was assayed in at least three independent CENP-A ChIP experiments. The qRT-PCR results for each primer pair were expressed on the y-axis as the fold enhancement between the CENP-A ChIP DNA and input DNA (= 1.93 ΔCt(CENP-A-Input) ) normalized to the value obtained for the positive control alpha satellite DNA primer pair (far right). The shaded region indicates the area determined to be the CENP-A domain in Figure 2. (b) The 34 qRT-PCR primer pairs and the 133 PCR products from this region on the PCR microarray (Figure 2) are shown. qRT-PCR primers that amplified products wholly contained within a PCR microarray fragment are indicated by numbers in parentheses; the rest are labeled alphabetically. Only qRT-PCR fragments shown in Table 1 are indicated; information for all other primers can be found in the Additional data file 3. CENP-A domains derived from the PCR microarray data are indicated. Genome coordinates correspond to the region of chr13 from the Human Genome Browser at UCSC (hg17) [50].
Figure Legend Snippet: qRT-PCR confirms two separate CenpA domains in the neocentromeric cell line BBB. (a) Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on equal amounts of total DNA obtained from centromere protein (CENP)-A chromatin immunoprecipitation (ChIP) DNA and Input DNA from BBB cell line. The thirty-four PCR primer pairs used (shown as black lines in the x-axis) amplified fragments from 150 to 250 base pairs contained within the 350 kb neocentromere region (see Figure 2). Each primer pair was assayed in at least three independent CENP-A ChIP experiments. The qRT-PCR results for each primer pair were expressed on the y-axis as the fold enhancement between the CENP-A ChIP DNA and input DNA (= 1.93 ΔCt(CENP-A-Input) ) normalized to the value obtained for the positive control alpha satellite DNA primer pair (far right). The shaded region indicates the area determined to be the CENP-A domain in Figure 2. (b) The 34 qRT-PCR primer pairs and the 133 PCR products from this region on the PCR microarray (Figure 2) are shown. qRT-PCR primers that amplified products wholly contained within a PCR microarray fragment are indicated by numbers in parentheses; the rest are labeled alphabetically. Only qRT-PCR fragments shown in Table 1 are indicated; information for all other primers can be found in the Additional data file 3. CENP-A domains derived from the PCR microarray data are indicated. Genome coordinates correspond to the region of chr13 from the Human Genome Browser at UCSC (hg17) [50].

Techniques Used: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Amplification, Positive Control, Microarray, Labeling, Derivative Assay

CENP-A nucleosomes are interspersed at variable densities throughout the core centromeric domain. (a) The 87.8 kilobase (kb) major domain. Shown are the putative subdomains of centromere protein (CENP)-A, with higher densities indicated by darker shading. The polymerase chain reaction (PCR) microarray fragments are shown below (see Figure 2). The fragments examined using the oligo array are shown in gray. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using CENP-A from cell line BBB was hybridized to a 70 mer oligonucleotide microarray containing two distinct subdomains of the major neocentromere domain, a 1.6 kb region at the 5' end (PCR fragments 3 and 4; Table 1) and a 2 kb region within the domain (PCR fragments 20 and 21). Three independent biological replicates were performed, and the mean log 2 Cy-5:Cy-3 intensity ratio (CENP-A ChIP to input) from each biologic replicate was scale normalized (SN). The result for each 70 mer oligomer is shown plotted on the y-axis with the standard error.
Figure Legend Snippet: CENP-A nucleosomes are interspersed at variable densities throughout the core centromeric domain. (a) The 87.8 kilobase (kb) major domain. Shown are the putative subdomains of centromere protein (CENP)-A, with higher densities indicated by darker shading. The polymerase chain reaction (PCR) microarray fragments are shown below (see Figure 2). The fragments examined using the oligo array are shown in gray. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using CENP-A from cell line BBB was hybridized to a 70 mer oligonucleotide microarray containing two distinct subdomains of the major neocentromere domain, a 1.6 kb region at the 5' end (PCR fragments 3 and 4; Table 1) and a 2 kb region within the domain (PCR fragments 20 and 21). Three independent biological replicates were performed, and the mean log 2 Cy-5:Cy-3 intensity ratio (CENP-A ChIP to input) from each biologic replicate was scale normalized (SN). The result for each 70 mer oligomer is shown plotted on the y-axis with the standard error.

Techniques Used: Polymerase Chain Reaction, Microarray, Chromatin Immunoprecipitation

Related Articles

Control:

Article Title: RNA expression profiling at the single molecule level
Article Snippet: .. For evaluation of sensitivity and dynamic range, probe oligonucleotide ([NH2-C12]ATAGAAATGCA GCGTGGATCTCTTAGCAGATTGAAACCGAGCTGTAGC GCTTGTGCCACC) (VBC-Genomics) and control oligonucleotides with a sequence identical to the target ([NH2-C12] GGTG GCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGAT CCACGCTGCATTTCTAT) were spotted with a MicroGridII arrayer (Genomic Solutions) using Stealth SMP3 Microarray Spotting Pins (TeleChem International, Inc.) onto 150-μm aldehyde coated coverslips (Schlapak et al. 2005). ..

Sequencing:

Article Title: RNA expression profiling at the single molecule level
Article Snippet: .. For evaluation of sensitivity and dynamic range, probe oligonucleotide ([NH2-C12]ATAGAAATGCA GCGTGGATCTCTTAGCAGATTGAAACCGAGCTGTAGC GCTTGTGCCACC) (VBC-Genomics) and control oligonucleotides with a sequence identical to the target ([NH2-C12] GGTG GCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGAT CCACGCTGCATTTCTAT) were spotted with a MicroGridII arrayer (Genomic Solutions) using Stealth SMP3 Microarray Spotting Pins (TeleChem International, Inc.) onto 150-μm aldehyde coated coverslips (Schlapak et al. 2005). ..

Microarray:

Article Title: RNA expression profiling at the single molecule level
Article Snippet: .. For evaluation of sensitivity and dynamic range, probe oligonucleotide ([NH2-C12]ATAGAAATGCA GCGTGGATCTCTTAGCAGATTGAAACCGAGCTGTAGC GCTTGTGCCACC) (VBC-Genomics) and control oligonucleotides with a sequence identical to the target ([NH2-C12] GGTG GCACAAGCGCTACAGCTCGGTTTCAATCTGCTAAGAGAT CCACGCTGCATTTCTAT) were spotted with a MicroGridII arrayer (Genomic Solutions) using Stealth SMP3 Microarray Spotting Pins (TeleChem International, Inc.) onto 150-μm aldehyde coated coverslips (Schlapak et al. 2005). ..

Article Title: Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens.
Article Snippet: Article history: Received 12 December 2007 Received in revised form 4 March 2008 Accepted 4 March 2008 Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability.. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring.. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences.



Similar Products

90
Arrayit Corporation the pin is a commercial microarray stealth printing pin, model smp3
The Pin Is A Commercial Microarray Stealth Printing Pin, Model Smp3, supplied by Arrayit Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/smp3+stealth+microarray+pins/smp3+pins/pm39396275-159-9-12
Average 90 stars, based on 1 article reviews
the pin is a commercial microarray stealth printing pin, model smp3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Arrayit Corporation microarray stealth printing pin smp3
Microarray Stealth Printing Pin Smp3, supplied by Arrayit Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/smp3+stealth+microarray+pins/smp3+pins/pm38522234-59-9-10
Average 90 stars, based on 1 article reviews
microarray stealth printing pin smp3 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
TeleChem International stealth smp3 microarray spotting pin
Genomic <t>microarray</t> analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).
Stealth Smp3 Microarray Spotting Pin, supplied by TeleChem International, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/smp3+stealth+microarray+pins/smp3+pins/pmc02323242-244-15-20
Average 90 stars, based on 1 article reviews
stealth smp3 microarray spotting pin - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Arrayit Corporation stealth smp3 microarray spotting pins
Genomic <t>microarray</t> analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).
Stealth Smp3 Microarray Spotting Pins, supplied by Arrayit Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/smp3+stealth+microarray+pins/smp3+pins/us11161868-516-5-11
Average 90 stars, based on 1 article reviews
stealth smp3 microarray spotting pins - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Arrayit Corporation smp3 stealth microarray pins
Genomic <t>microarray</t> analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).
Smp3 Stealth Microarray Pins, supplied by Arrayit Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/smp3+stealth+microarray+pins/smp3+pins/pm27235994-75-10-14
Average 90 stars, based on 1 article reviews
smp3 stealth microarray pins - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
TeleChem International arrayit stealth smp3 quill-tipped microarray pins
Genomic <t>microarray</t> analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).
Arrayit Stealth Smp3 Quill Tipped Microarray Pins, supplied by TeleChem International, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/smp3+stealth+microarray+pins/smp3+pins/pm19636319-73-25-27
Average 90 stars, based on 1 article reviews
arrayit stealth smp3 quill-tipped microarray pins - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Genomic microarray analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: Genomic microarray analysis of CENP-C and CENP-H binding domains in two independent 13q32/33 neocentromeres. (a) Ideogrammatic representation of the two neocentric chromosomes analyzed. From left to right: a normal chromosome 13, the invdup13q21 in IMS13q with a neocentromere in band 13q32, and the invdup13q21 in BBB with a neocentromere in band 13q33.1. An expansion of the 13q31.3 to 13q33.2 area included in the bacterial artificial chromosome (BAC) CHIP is shown. The position and size of each previously mapped centromere protein (CENP)-A domain from Alonso and coworkers [32] are indicated. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-C (circles) and CENP-H (triangles) from cell lines BBB and IMS13q was hybridized to a contiguous BAC microarray spanning 14 megabases (Mb) from 13q31.3 to 13q33.2. Shown across the bottom of the graph is the tiling path of the unique sequenced regions for each BAC, the previously determined CENP-A domains [32] in cell lines BBB and IMS13q, and the genes in the region. Three independent biologic replicates were performed for each ChIP from each cell line, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input) with standard error (SE) were plotted on the y-axis for each BAC. Positive intensity ratios were identified as those that were at least three times the standard deviation (SD) from the experimental mean (gray or black dashed lines; see Materials and methods). For cell line BBB, CENP-C ChIP, the experimental mean was 0 ± 0.82 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 6.42 ± 0.39 SE and BAC RP11-46I10 = 4.66 ± 0.92 SE. BAC RP11-29B2 was slightly increased (1.18 ± 1.2 SE) but not statistically significantly. All other BACs ranged from -1.1 to ≤ 0.96. For cell line BBB, CENP-H ChIP, the experimental mean was -0.02 ± 0.75 SD. Positive values ≥ 2.2 (grey dashed line) were as follows: alpha sat = 4.92 ± 1.86 SE and BAC RP11-46I10 = 5.57 ± 0.77 SE. BAC RP11-29B2 was slightly increased (1.58 ± 0.71 SE) but not statistically significantly. All other BACs ranged from -1.27 to ≤ 1.03. For cell line IMS13q, CENP-C ChIP, the experimental mean was 0 ± 0.84 SD. Positive values ≥ 2.5 (black dashed line) were as follows: alpha sat = 5.26 ± 0.38 SE and BAC RP11-199B17 = 4.95 ± 0.86 SE. All other BACs ranged from -1.7 to ≤ 0.93. For cell line IMS13q, CENP-H, the experimental mean was 0.00 ± 0.64 SD. Positive values ≥ 1.9 (grey dashed line) were as follows: alpha sat = 2.63 ± 1.03 SE and BAC RP11-199B17 = 3.95 ± 1.06 SE. All other BACs ranged from -1.17 to ≤ 1.13. (c) Expansion of BAC map in regions that are positive for CENP-C and CENP-H in each neocentromere examined, showing BAC names and overlaps, the genes, and the previously determined CENP-A domains. For cell line BBB, the CENP-A, CENP-C, and CENP-H were mapped to the identical BACs (negative for RP11-811P12, strongly positive for BAC 46I10, and weakly positive for 29B2). For cell line IMS13q, the CENP-A mapped to two contiguous BACs (RP11-721F4 and RP11-199B17), whereas CENP-C and CENP-H mapped only to one BAC (RP11-199B17).

Article Snippet: Approximately 50 pg DNA was spotted onto Nexterion slides E (Schott, Mainz, Germany), using a Stealth SMP3 Microarray Spotting Pin (Telechem International, Inc., Sunnyvale, CA, USA) and Genemachine Omnigrid 100 (Genomics Solutions Inc. Ann Arbor, MI, USA).

Techniques: Microarray, Binding Assay, Chromatin Immunoprecipitation, Standard Deviation

The BBB neocentromere contains a major and a minor centromere chromatin domain. DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-A, CENP-C, and CENP-H from cell line BBB was hybridized to a custom made microarray containing 257 unique polymerase chain reaction (PCR) fragments. Three independent biological replicates were performed for each antibody, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input), were plotted on the y-axis with the standard error (SE) for each PCR fragment. Intensity ratios at least three times the standard deviation (SD) from the background mean (dashed line) were considered positives (see Materials and methods). An alpha satellite containing plasmid was included as a positive control (far right). (a) Centromere protein (CENP)-A ChIP. The major CENP-A domain was about 80.3 kilobases (kb; shaded region), with positive intensity ratios 1.17 to 2.46. The minor domain was about 8.5 kb (shaded region) and was approximately 162 kb downstream from the major domain; intensity ratios were 1.14 to 1.33. Background experimental mean was -0.39 ± 0.47 SD, one-tailed distribution cut-off was ≤ 0.68, positive values were ≥ 1.02 (dashed line). Alpha satellite = 1.63 ± 0.18 SE. (b) CENP-C ChIP. Major CENP-C domain was 87.8 kb (shaded region). Intensity ratios were 0.67 to 3.41. Minor domain was 8.5 kb; intensity ratios were 0.65 to 1.07 (shaded region). Background experimental mean was -0.37 ± 0.34 SD, one-tailed distribution cut-off was ≤ 0.31, positive values were ≥ 0.65 (dashed line). Alpha satellite = 2.36 ± 0.70 SE. (c) CENP-H ChIP. Major CENP-H domain was about 86.3 kb (shaded region), and positive intensity ratios were 0.64 to 3.35. Minor domain was about 1.9 kb (shaded region), and intensity ratios were 0.82 and 1.14. Background experimental mean was -0.33 ± 0.32 SD, one-tailed distribution cutoff was ≤ 0.56, positive values were ≥ 0.63 (dashed lines). Alpha sat = 2.06 ± 0.59 SE. (d) The 2.3 megabase (Mb) region included in the PCR CHIP. The central 350 kb region, covered by PCR fragments at high density. The adjacent megabase on either side of the central region, shown at a 10 fold reduced scale, was covered by PCR fragments at decreasing density. PCR microarray fragments listed in Table 1, found at the edges of CENP-A, CENP-C and CENP-H domains, and the negative values within the first domain, are shown. The major and minor chromatin domains are shown by the rectangles. The tiling path of the unique sequenced regions of each bacterial artificial chromosome (BAC) and their overlaps are shown within the 350 kb region. The corresponding Repeat Masker data from the Human Genome Browser at UCSC and thegenes in the area are indicated [50].

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: The BBB neocentromere contains a major and a minor centromere chromatin domain. DNA obtained from chromatin immunoprecipitation (ChIP) using antibodies to CENP-A, CENP-C, and CENP-H from cell line BBB was hybridized to a custom made microarray containing 257 unique polymerase chain reaction (PCR) fragments. Three independent biological replicates were performed for each antibody, and the scale normalized mean log 2 Cy-5:Cy-3 intensity ratios (ChIP to input), were plotted on the y-axis with the standard error (SE) for each PCR fragment. Intensity ratios at least three times the standard deviation (SD) from the background mean (dashed line) were considered positives (see Materials and methods). An alpha satellite containing plasmid was included as a positive control (far right). (a) Centromere protein (CENP)-A ChIP. The major CENP-A domain was about 80.3 kilobases (kb; shaded region), with positive intensity ratios 1.17 to 2.46. The minor domain was about 8.5 kb (shaded region) and was approximately 162 kb downstream from the major domain; intensity ratios were 1.14 to 1.33. Background experimental mean was -0.39 ± 0.47 SD, one-tailed distribution cut-off was ≤ 0.68, positive values were ≥ 1.02 (dashed line). Alpha satellite = 1.63 ± 0.18 SE. (b) CENP-C ChIP. Major CENP-C domain was 87.8 kb (shaded region). Intensity ratios were 0.67 to 3.41. Minor domain was 8.5 kb; intensity ratios were 0.65 to 1.07 (shaded region). Background experimental mean was -0.37 ± 0.34 SD, one-tailed distribution cut-off was ≤ 0.31, positive values were ≥ 0.65 (dashed line). Alpha satellite = 2.36 ± 0.70 SE. (c) CENP-H ChIP. Major CENP-H domain was about 86.3 kb (shaded region), and positive intensity ratios were 0.64 to 3.35. Minor domain was about 1.9 kb (shaded region), and intensity ratios were 0.82 and 1.14. Background experimental mean was -0.33 ± 0.32 SD, one-tailed distribution cutoff was ≤ 0.56, positive values were ≥ 0.63 (dashed lines). Alpha sat = 2.06 ± 0.59 SE. (d) The 2.3 megabase (Mb) region included in the PCR CHIP. The central 350 kb region, covered by PCR fragments at high density. The adjacent megabase on either side of the central region, shown at a 10 fold reduced scale, was covered by PCR fragments at decreasing density. PCR microarray fragments listed in Table 1, found at the edges of CENP-A, CENP-C and CENP-H domains, and the negative values within the first domain, are shown. The major and minor chromatin domains are shown by the rectangles. The tiling path of the unique sequenced regions of each bacterial artificial chromosome (BAC) and their overlaps are shown within the 350 kb region. The corresponding Repeat Masker data from the Human Genome Browser at UCSC and thegenes in the area are indicated [50].

Article Snippet: Approximately 50 pg DNA was spotted onto Nexterion slides E (Schott, Mainz, Germany), using a Stealth SMP3 Microarray Spotting Pin (Telechem International, Inc., Sunnyvale, CA, USA) and Genemachine Omnigrid 100 (Genomics Solutions Inc. Ann Arbor, MI, USA).

Techniques: Chromatin Immunoprecipitation, Microarray, Polymerase Chain Reaction, Standard Deviation, Plasmid Preparation, Positive Control, One-tailed Test

PCR  microarray  and qRT-PCR values across the CENP-A major and minor domains

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: PCR microarray and qRT-PCR values across the CENP-A major and minor domains

Article Snippet: Approximately 50 pg DNA was spotted onto Nexterion slides E (Schott, Mainz, Germany), using a Stealth SMP3 Microarray Spotting Pin (Telechem International, Inc., Sunnyvale, CA, USA) and Genemachine Omnigrid 100 (Genomics Solutions Inc. Ann Arbor, MI, USA).

Techniques: Microarray

qRT-PCR confirms two separate CenpA domains in the neocentromeric cell line BBB. (a) Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on equal amounts of total DNA obtained from centromere protein (CENP)-A chromatin immunoprecipitation (ChIP) DNA and Input DNA from BBB cell line. The thirty-four PCR primer pairs used (shown as black lines in the x-axis) amplified fragments from 150 to 250 base pairs contained within the 350 kb neocentromere region (see Figure 2). Each primer pair was assayed in at least three independent CENP-A ChIP experiments. The qRT-PCR results for each primer pair were expressed on the y-axis as the fold enhancement between the CENP-A ChIP DNA and input DNA (= 1.93 ΔCt(CENP-A-Input) ) normalized to the value obtained for the positive control alpha satellite DNA primer pair (far right). The shaded region indicates the area determined to be the CENP-A domain in Figure 2. (b) The 34 qRT-PCR primer pairs and the 133 PCR products from this region on the PCR microarray (Figure 2) are shown. qRT-PCR primers that amplified products wholly contained within a PCR microarray fragment are indicated by numbers in parentheses; the rest are labeled alphabetically. Only qRT-PCR fragments shown in Table 1 are indicated; information for all other primers can be found in the Additional data file 3. CENP-A domains derived from the PCR microarray data are indicated. Genome coordinates correspond to the region of chr13 from the Human Genome Browser at UCSC (hg17) [50].

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: qRT-PCR confirms two separate CenpA domains in the neocentromeric cell line BBB. (a) Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on equal amounts of total DNA obtained from centromere protein (CENP)-A chromatin immunoprecipitation (ChIP) DNA and Input DNA from BBB cell line. The thirty-four PCR primer pairs used (shown as black lines in the x-axis) amplified fragments from 150 to 250 base pairs contained within the 350 kb neocentromere region (see Figure 2). Each primer pair was assayed in at least three independent CENP-A ChIP experiments. The qRT-PCR results for each primer pair were expressed on the y-axis as the fold enhancement between the CENP-A ChIP DNA and input DNA (= 1.93 ΔCt(CENP-A-Input) ) normalized to the value obtained for the positive control alpha satellite DNA primer pair (far right). The shaded region indicates the area determined to be the CENP-A domain in Figure 2. (b) The 34 qRT-PCR primer pairs and the 133 PCR products from this region on the PCR microarray (Figure 2) are shown. qRT-PCR primers that amplified products wholly contained within a PCR microarray fragment are indicated by numbers in parentheses; the rest are labeled alphabetically. Only qRT-PCR fragments shown in Table 1 are indicated; information for all other primers can be found in the Additional data file 3. CENP-A domains derived from the PCR microarray data are indicated. Genome coordinates correspond to the region of chr13 from the Human Genome Browser at UCSC (hg17) [50].

Article Snippet: Approximately 50 pg DNA was spotted onto Nexterion slides E (Schott, Mainz, Germany), using a Stealth SMP3 Microarray Spotting Pin (Telechem International, Inc., Sunnyvale, CA, USA) and Genemachine Omnigrid 100 (Genomics Solutions Inc. Ann Arbor, MI, USA).

Techniques: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation, Amplification, Positive Control, Microarray, Labeling, Derivative Assay

CENP-A nucleosomes are interspersed at variable densities throughout the core centromeric domain. (a) The 87.8 kilobase (kb) major domain. Shown are the putative subdomains of centromere protein (CENP)-A, with higher densities indicated by darker shading. The polymerase chain reaction (PCR) microarray fragments are shown below (see Figure 2). The fragments examined using the oligo array are shown in gray. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using CENP-A from cell line BBB was hybridized to a 70 mer oligonucleotide microarray containing two distinct subdomains of the major neocentromere domain, a 1.6 kb region at the 5' end (PCR fragments 3 and 4; Table 1) and a 2 kb region within the domain (PCR fragments 20 and 21). Three independent biological replicates were performed, and the mean log 2 Cy-5:Cy-3 intensity ratio (CENP-A ChIP to input) from each biologic replicate was scale normalized (SN). The result for each 70 mer oligomer is shown plotted on the y-axis with the standard error.

Journal: Genome Biology

Article Title: Co-localization of CENP-C and CENP-H to discontinuous domains of CENP-A chromatin at human neocentromeres

doi: 10.1186/gb-2007-8-7-r148

Figure Lengend Snippet: CENP-A nucleosomes are interspersed at variable densities throughout the core centromeric domain. (a) The 87.8 kilobase (kb) major domain. Shown are the putative subdomains of centromere protein (CENP)-A, with higher densities indicated by darker shading. The polymerase chain reaction (PCR) microarray fragments are shown below (see Figure 2). The fragments examined using the oligo array are shown in gray. (b) DNA obtained from chromatin immunoprecipitation (ChIP) using CENP-A from cell line BBB was hybridized to a 70 mer oligonucleotide microarray containing two distinct subdomains of the major neocentromere domain, a 1.6 kb region at the 5' end (PCR fragments 3 and 4; Table 1) and a 2 kb region within the domain (PCR fragments 20 and 21). Three independent biological replicates were performed, and the mean log 2 Cy-5:Cy-3 intensity ratio (CENP-A ChIP to input) from each biologic replicate was scale normalized (SN). The result for each 70 mer oligomer is shown plotted on the y-axis with the standard error.

Article Snippet: Approximately 50 pg DNA was spotted onto Nexterion slides E (Schott, Mainz, Germany), using a Stealth SMP3 Microarray Spotting Pin (Telechem International, Inc., Sunnyvale, CA, USA) and Genemachine Omnigrid 100 (Genomics Solutions Inc. Ann Arbor, MI, USA).

Techniques: Polymerase Chain Reaction, Microarray, Chromatin Immunoprecipitation